Read the Paper at
Nucleic Acids Research
Web Servers Issue 2010
Ire Ipr1

Structure of iron regulatory protein 1 complexed with ferritin IRE-RNA.(PDB: 2IPY)

Welcome to the SIREs server v2.0 what's new

The SIREs (searching for IREs) web server will predict iron-responsive elements in RNA or DNA sequences based on a sequence searcher Perl program.

To get more information about iron-responsive elements prediction algorithm and the iron regulatory proteins/iron-responsive elements regulatory system, please go to the Documentation section

Help

HELP: Interactive vs Batch Serves
Use the interactive mode to submit less than 50000 residues for a detailed results and graphical representation of your IREs. If you have a large set of sequences use the batch mode. Close

Example:

>Mouse Ferritin H (NM_010239) 1-240
CAGACGTTCTCGCCCAGAGTCGCCGCGGTTTCCTGCTTCAACAGTGCTTGAACGGAACCC
GGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGT
CGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGT
CTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGA

						

View a multiple sequence example output




View an example output here