Here are your results

You submited 3 sequence/s. We found 7 IRE/s in 3 different sequence/s:

Sequence Start End Loop Type Mismatches 3' Bulge N25 GU/UG Pred. Loop Pred. Pairs Pred. C8 Free Energy Quality
HUMAN-SLC11A2-IRE-EN... 18011833 1 - N22b:T A 1 -6.10 High
HUMANFTL-NM_000146 2657 1 - - C 1 -1.50 High
mouse-TFR1-NM_011638 31643195 2 - - A 0 -7.20 High
mouse-TFR1-NM_011638 32233254 1 - - A 0 -8.40 High
mouse-TFR1-NM_011638 36023633 1 - - A 1 -9.00 High
mouse-TFR1-NM_011638 36673698 1 - - A 0 -7.90 High
mouse-TFR1-NM_011638 37143745 1 - - A 0 -8.10 High
Download list in GFF format
Help

HELP: GFF Format
GFF format if you use standard sequence ids, allows you to load your results in a Genome Browser Close

Sequence ID

HUMAN-SLC11A2-IRE-ENSEMBL

Sequence Context

Position in sequence: 1801-1833

  1667   TGGCAATGTTTGATTGCACTGGGCATGTCCTTCCTGGACTGTGGGCATACGGTAAGCATC    1726
  1727   TCTAAAGGCCTGCTGACAGAAGAAGCCACCCGTGGCTACGTTAAATAACACTGGATTAGT    1786
  1787   CTGTCTTCTGCAGGTAGCCATCAGAGCCAGTGTGTTTCTATGGTTTACTGTGTGAACATA    1846
  1847   GCCAAAAGTATGTGCCGTTGCACAGACTGTGTTTATGACTCAACCGTTGGTTGGAAAAGA    1906
  1907   CTTTGTTTCATGTGTATTTGAAAGATGGAATTATTTTTTCCTTCCTGACCTAACCTTAGA    1966
Download in FASTA format
Help

HELP: FASTA Format
download the IRE sequence in FASTA format if you want to use it in sequence analysis programs as BLAST.Close

Overall Quality: High

  • SIREs Prediction
  • RNAfold Prediction
    • Help

    HELP: SIRES Prediction/RNAFold Prediction
    Predicted pairings are graphically displayed using our algorithm and the RNAFold predicted program (Vienna RNA Package) Close

Download in as an image or in Vienna format
Help

HELP: Vienna Format
download the IRE sequence in Vienna format to use it with the Vienna package Close

Download in as an image or in Vienna format
Help

HELP: Vienna Format
download the IRE sequence in Vienna format to use it with the Vienna package Close

  • Report

    Click on the features to learn what they mean

  • SIREs Prediction

  • Loop is of the canonical type. Motif class: 1

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Please look at the "Docs Pages" to know more Close

  • No Mismatches

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch an a bulge (see the Bulge help) are incompatibleClose

  • 3' Bulge at postion 22b

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b,21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatibleClose

  • n25 is not a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs).Close

  • 1 GU Pair

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable.Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop matches the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop is also fold as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem does NOT match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -6.10 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information.Close

Hover over the features to highlight them in the structure

Top

Sequence ID

HUMANFTL-NM_000146

Sequence Context

Position in sequence: 26-57

     1                                                    GCAGTTCGGCG      11
    12   GTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGATCCGGGGACTCTC      71
    72   TTCCAGCCTCCGACCGCCCTCCGATTTCCTCTCCGCTTGCAACCTCCGGGACCATCTTCT     131
   132   CGGCCATCTCCTGCTTCTGGGACCTGCCAGCACCGTTTTTGTGGTTAGCTCCTTCTTGCC     191
Download in FASTA format
Help

HELP: FASTA Format
download the IRE sequence in FASTA format if you want to use it in sequence analysis programs as BLAST.Close

Overall Quality: High

  • SIREs Prediction
  • RNAfold Prediction
    • Help

    HELP: SIRES Prediction/RNAFold Prediction
    Predicted pairings are graphically displayed using our algorithm and the RNAFold predicted program (Vienna RNA Package) Close

Download in as an image or in Vienna format
Help

HELP: Vienna Format
download the IRE sequence in Vienna format to use it with the Vienna package Close

Download in as an image or in Vienna format
Help

HELP: Vienna Format
download the IRE sequence in Vienna format to use it with the Vienna package Close

  • Report

    Click on the features to learn what they mean

  • SIREs Prediction

  • Loop is of the canonical type. Motif class: 1

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Please look at the "Docs Pages" to know more Close

  • No Mismatches

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch an a bulge (see the Bulge help) are incompatibleClose

  • No 3' Bulges

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b,21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatibleClose

  • n25 is not a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs).Close

  • 1 GU Pair

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable.Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop matches the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop is also fold as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -1.50 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information.Close

Hover over the features to highlight them in the structure

Top

Sequence ID

mouse-TFR1-NM_011638

Sequence Context

Position in sequence: 3164-3195

  3030   CCAACATTTTCTGAAAAAGAACAAGTTTTAGACTCAATTTGTCAGACTTGAAAAGAACAC    3089
  3090   ACTGCCAAGTTTTGGCCAAAGTGTTAGTCTTCAGGAAAGCTTTCTATCATTTTGGCACTG    3149
  3150   AGATATTTATTGTTTATTTATCAGTGACAGAGTTCACTATAAATAGTGTTGTTTTTTTTT    3209
  3210   TATATATAGAAGATAATTATCGGAAGCAGTGCCTTCCATAATTATGACAGTTATACTGTC    3269
  3270   GTTTTCTTTTAATAAAAGCAGCATCTGCTAATGAGACCCACAGATACTGGAAGTTTTGCA    3329
Download in FASTA format
Help

HELP: FASTA Format
download the IRE sequence in FASTA format if you want to use it in sequence analysis programs as BLAST.Close

Overall Quality: High

  • SIREs Prediction
  • RNAfold Prediction
    • Help

    HELP: SIRES Prediction/RNAFold Prediction
    Predicted pairings are graphically displayed using our algorithm and the RNAFold predicted program (Vienna RNA Package) Close

Download in as an image or in Vienna format
Help

HELP: Vienna Format
download the IRE sequence in Vienna format to use it with the Vienna package Close

Download in as an image or in Vienna format
Help

HELP: Vienna Format
download the IRE sequence in Vienna format to use it with the Vienna package Close

  • Report

    Click on the features to learn what they mean

  • SIREs Prediction

  • Loop is of the canonical type. Motif class: 2

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Please look at the "Docs Pages" to know more Close

  • No Mismatches

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch an a bulge (see the Bulge help) are incompatibleClose

  • No 3' Bulges

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b,21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatibleClose

  • n25 is not a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs).Close

  • No GU Pairs

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable.Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop matches the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop is also fold as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -7.20 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information.Close

Hover over the features to highlight them in the structure

Top

Sequence ID

mouse-TFR1-NM_011638

Sequence Context

Position in sequence: 3223-3254

  3089   CACTGCCAAGTTTTGGCCAAAGTGTTAGTCTTCAGGAAAGCTTTCTATCATTTTGGCACT    3148
  3149   GAGATATTTATTGTTTATTTATCAGTGACAGAGTTCACTATAAATAGTGTTGTTTTTTTT    3208
  3209   TTATATATAGAAGATAATTATCGGAAGCAGTGCCTTCCATAATTATGACAGTTATACTGT    3268
  3269   CGTTTTCTTTTAATAAAAGCAGCATCTGCTAATGAGACCCACAGATACTGGAAGTTTTGC    3328
  3329   ACTTATGGTCAGCACTTGCAACTTTAGGAAGGAAGAATGCCACAATCCAAATAATATGAG    3388
Download in FASTA format
Help

HELP: FASTA Format
download the IRE sequence in FASTA format if you want to use it in sequence analysis programs as BLAST.Close

Overall Quality: High

  • SIREs Prediction
  • RNAfold Prediction
    • Help

    HELP: SIRES Prediction/RNAFold Prediction
    Predicted pairings are graphically displayed using our algorithm and the RNAFold predicted program (Vienna RNA Package) Close

Download in as an image or in Vienna format
Help

HELP: Vienna Format
download the IRE sequence in Vienna format to use it with the Vienna package Close

Download in as an image or in Vienna format
Help

HELP: Vienna Format
download the IRE sequence in Vienna format to use it with the Vienna package Close

  • Report

    Click on the features to learn what they mean

  • SIREs Prediction

  • Loop is of the canonical type. Motif class: 1

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Please look at the "Docs Pages" to know more Close

  • No Mismatches

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch an a bulge (see the Bulge help) are incompatibleClose

  • No 3' Bulges

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b,21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatibleClose

  • n25 is not a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs).Close

  • No GU Pairs

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable.Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop matches the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop is also fold as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -8.40 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information.Close

Hover over the features to highlight them in the structure

Top

Sequence ID

mouse-TFR1-NM_011638

Sequence Context

Position in sequence: 3602-3633

  3468   TGTGGCCAAGTTAAATGTCATTTAAAGGCTATGGTAGTACTTACATCTACAAAATTTTAC    3527
  3528   AGCTCAATTTATTCAAGATGTAACTCAAAATCAATTTTGCAAAATTTCCAGTACCTTTGT    3587
  3588   CACAAACTTAACTCACATTATCGGGAGCAGTGTCTTCCATAATGCATAAAGAACAAGGTA    3647
  3648   GTTTTTGCCTACCACAGTGTCTATATCGGAGACAGTGATCTCCATATGTTACACTAAGGG    3707
  3708   TGTACGTAATTATCGGGAACAGTGTTTCCCATAATTTTCTTCATGCAATGACATCTTCAG    3767
Download in FASTA format
Help

HELP: FASTA Format
download the IRE sequence in FASTA format if you want to use it in sequence analysis programs as BLAST.Close

Overall Quality: High

  • SIREs Prediction
  • RNAfold Prediction
    • Help

    HELP: SIRES Prediction/RNAFold Prediction
    Predicted pairings are graphically displayed using our algorithm and the RNAFold predicted program (Vienna RNA Package) Close

Download in as an image or in Vienna format
Help

HELP: Vienna Format
download the IRE sequence in Vienna format to use it with the Vienna package Close

Download in as an image or in Vienna format
Help

HELP: Vienna Format
download the IRE sequence in Vienna format to use it with the Vienna package Close

  • Report

    Click on the features to learn what they mean

  • SIREs Prediction

  • Loop is of the canonical type. Motif class: 1

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Please look at the "Docs Pages" to know more Close

  • No Mismatches

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch an a bulge (see the Bulge help) are incompatibleClose

  • No 3' Bulges

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b,21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatibleClose

  • n25 is not a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs).Close

  • 1 GU Pair

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable.Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop matches the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop is also fold as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -9.00 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information.Close

Hover over the features to highlight them in the structure

Top

Sequence ID

mouse-TFR1-NM_011638

Sequence Context

Position in sequence: 3667-3698

  3533   AATTTATTCAAGATGTAACTCAAAATCAATTTTGCAAAATTTCCAGTACCTTTGTCACAA    3592
  3593   ACTTAACTCACATTATCGGGAGCAGTGTCTTCCATAATGCATAAAGAACAAGGTAGTTTT    3652
  3653   TGCCTACCACAGTGTCTATATCGGAGACAGTGATCTCCATATGTTACACTAAGGGTGTAC    3712
  3713   GTAATTATCGGGAACAGTGTTTCCCATAATTTTCTTCATGCAATGACATCTTCAGAGCTT    3772
  3773   GAAGATCGTTAGTATCTAACATGAATTCCTAACTTCCTGTAGCTCCTTAGTTTTAGTTGC    3832
Download in FASTA format
Help

HELP: FASTA Format
download the IRE sequence in FASTA format if you want to use it in sequence analysis programs as BLAST.Close

Overall Quality: High

  • SIREs Prediction
  • RNAfold Prediction
    • Help

    HELP: SIRES Prediction/RNAFold Prediction
    Predicted pairings are graphically displayed using our algorithm and the RNAFold predicted program (Vienna RNA Package) Close

Download in as an image or in Vienna format
Help

HELP: Vienna Format
download the IRE sequence in Vienna format to use it with the Vienna package Close

Download in as an image or in Vienna format
Help

HELP: Vienna Format
download the IRE sequence in Vienna format to use it with the Vienna package Close

  • Report

    Click on the features to learn what they mean

  • SIREs Prediction

  • Loop is of the canonical type. Motif class: 1

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Please look at the "Docs Pages" to know more Close

  • No Mismatches

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch an a bulge (see the Bulge help) are incompatibleClose

  • No 3' Bulges

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b,21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatibleClose

  • n25 is not a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs).Close

  • No GU Pairs

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable.Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop matches the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop is also fold as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -7.90 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information.Close

Hover over the features to highlight them in the structure

Top

Sequence ID

mouse-TFR1-NM_011638

Sequence Context

Position in sequence: 3714-3745

  3580   ACCTTTGTCACAAACTTAACTCACATTATCGGGAGCAGTGTCTTCCATAATGCATAAAGA    3639
  3640   ACAAGGTAGTTTTTGCCTACCACAGTGTCTATATCGGAGACAGTGATCTCCATATGTTAC    3699
  3700   ACTAAGGGTGTACGTAATTATCGGGAACAGTGTTTCCCATAATTTTCTTCATGCAATGAC    3759
  3760   ATCTTCAGAGCTTGAAGATCGTTAGTATCTAACATGAATTCCTAACTTCCTGTAGCTCCT    3819
  3820   TAGTTTTAGTTGCAAAAAACATTTGTGGTCATTGAGCATTTGGTGGGTAAAATCAACTGC    3879
Download in FASTA format
Help

HELP: FASTA Format
download the IRE sequence in FASTA format if you want to use it in sequence analysis programs as BLAST.Close

Overall Quality: High

  • SIREs Prediction
  • RNAfold Prediction
    • Help

    HELP: SIRES Prediction/RNAFold Prediction
    Predicted pairings are graphically displayed using our algorithm and the RNAFold predicted program (Vienna RNA Package) Close

Download in as an image or in Vienna format
Help

HELP: Vienna Format
download the IRE sequence in Vienna format to use it with the Vienna package Close

Download in as an image or in Vienna format
Help

HELP: Vienna Format
download the IRE sequence in Vienna format to use it with the Vienna package Close

  • Report

    Click on the features to learn what they mean

  • SIREs Prediction

  • Loop is of the canonical type. Motif class: 1

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Please look at the "Docs Pages" to know more Close

  • No Mismatches

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch an a bulge (see the Bulge help) are incompatibleClose

  • No 3' Bulges

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b,21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatibleClose

  • n25 is not a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs).Close

  • No GU Pairs

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable.Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop matches the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop is also fold as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -8.10 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information.Close

Hover over the features to highlight them in the structure

Top

Download all files from this job