News

Jan 10, 2010 A new motif (8-CNNNNNAAGUUN-19) has been added to the IRE search algorithm. It will show up in the results table as Motif 19. Click here to see an example.
Read the Paper at
Nucleic Acids Research
Web Servers Issue 2010 Ire Ipr1

Structure of iron regulatory protein 1 complexed with ferritin IRE-RNA.(PDB: 2IPY)

Welcome to the SIREs server

The SIREs (searching for IREs) web server will predict iron-responsive elements in RNA or DNA sequences based on a sequence searcher Perl program.

To get more information about iron-responsive elements prediction algorithm and the iron regulatory proteins/iron-responsive elements regulatory system, please go to the Documentation section

Example:

>Mouse Ferritin H (NM_010239) 1-240
CAGACGTTCTCGCCCAGAGTCGCCGCGGTTTCCTGCTTCAACAGTGCTTGAACGGAACCC
GGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGT
CGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGT
CTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGA

View a multiple sequence example output